FLU SINGAPORE FLU BURUNG FLU TULANG FLU PERUT DAN CARA MENGOBATINYA BY RIZANET

Flu Singapore By Rizanet
DAFTAR ISI :
"PENYEBAB"
*EPIDEMIOLOGI:*
*DIAGNOSA LABORATORIUM :*
*PENGOBATAN*
*PENCEGAHAN*
"MACAM FLU"
"TIP MUDAH OBATNYA"
Sebenarnya adalah penyakit yang di dunia kedokteran dikenal sebagai *Hand, Foot, and Mouth Disease (HFMD)* atau dalam bahasa Indonesia *Penyakit Tangan, Kaki dan Mulut (PTKM)*.

Penyakit ini sesungguhnya sudah lama ada di dunia. Berdasar laporan yang ada, kejadian luar biasa penyakit ini sudah ada di tahun 1957 di Toronto, Kanada. Sejak itu terdapat banyak kejadian di seluruh dunia. Di Indonesia sendiri sebenarnya penyakit ini bukan penyakit baru.

Istilah “Flu Singapore” muncul karena saat itu terjadi ledakan kasus dan kematian akibat penyakit ini di Singapura. Karena gejalanya mirip flu, dan saat itu terjadi di Singapura (dan kemudian juga terjadi di Indonesia),
banyak media cetak yang membuat istilah “flu Singapore”, walaupun ini bukan terminologi yang baku.


"PENYEBAB"


PTKM ini adalah penyakit infeksi yang disebabkan oleh virus RNA yang masuk

dalam famili *Picornaviridae* (*Pico*, Spanyol = kecil ), *Genus Enterovirus * ( non Polio ). Genus yang lain adalah *Rhinovirus, Cardiovirus, Apthovirus

*. Di dalam Genus enterovirus terdiri dari *Coxsackie A* virus, *Coxsackie B

* virus, *Echovirus* dan *Enterovirus*.

Penyebab PTKM yang paling sering pada pasien rawat jalan adalah *Coxsackie

A16*, sedangkan yang sering memerlukan perawatan karena keadaannya lebih

berat atau ada komplikasi sampai meninggal adalah *Enterovirus 71*. Berbagai

enterovirus dapat menyebabkan berbagai penyakit.


*EPIDEMIOLOGI:*

Penyakit ini sangat menular dan sering terjadi dalam musim panas. PTKM adalah penyakit yang kerap terjadi pada kelompok masyarakat yang padat dan menyerang anak-anak usia 2 minggu sampai 5 tahun ( kadang sampai 10 tahun ).

Orang dewasa umumnya lebih kebal terhadap enterovirus, walau bisa juga terkena. Penularannya melalui jalur fekal-pral (pencernaan) dan saluran pernapasan, yaitu dari droplet (butiran ludah), pilek, air liur, tinja, cairan vesikel (kelainan kulit berupa gelembung kecil berisi cairan) atau ekskreta. Penularan kontak tidak langsung melalui barang, handuk, baju, peralatan makanan, dan mainan yang terkontaminasi oleh sekresi itu. Tidak ada vektor tetapi ada pembawa (“carrier”) seperti lalat dan kecoa. Penyakit ini memberi imunitas spesifik, namun anak dapat terkena PTKM lagi oleh virus *strain Enterovirus* lainnya.

Masa Inkubasi 2 – 5 hari.

*GEJALA*

Mula-mula demam tidak tinggi 2-3 hari, diikuti sakit leher (faringitis), tidak ada nafsu makan, pilek, gejala seperti “flu” pada umumnya yang tak mematikan. Timbul vesikel yang kemudian pecah, ada 3-10 ulkus di mulut seperti sariawan ( lidah, gusi, pipi sebelah dalam ) terasa nyeri sehingga sukar untuk menelan.

Bersamaan dengan itu timbul rash/ruam atau vesikel (lepuh kemerahan/blister yang kecil dan rata), papulovesikel yang tidak gatal ditelapak tangan dan kaki. Kadang-kadang rash/ruam (makulopapel) ada dibokong. Penyakit ini umumnya akan membaik sendiri dalam 7-10 hari, dan tidak perlu dirawat di rumah sakit.

Bila ada gejala yang cukup berat, barulah penderita perlu dirawat di rumah

sakit. Gejala yang cukup berat tersebut antara lain :

- Hiperpireksia, yaitu demam tinggi dengan suhu lebih dari 39 C.

– Demam tidak turun-turun

– Takikardia (nadi menjadi cepat)

– Takipneu, yaitu napas jadi cepat dan sesak

– Malas makan, muntah, atau diare berulang dengan dehidrasi.

– Letargi, lemas, dan mengantuk terus

– Nyeri pada leher, lengan,dan kaki.

– Kejang-kejang, atau terjadi kelumpuhan pada saraf kranial

- Keringat dingin

– Fotofobia (tidak tahan melihat sinar)

– Ketegangan pada daerah perut

– Halusinasi atau gangguan kesadaran

Komplikasi penyakit ini adalah :

- *Meningitis* (radang selaput otak) yang aseptik

– *Ensefalitis* (radang otak)

– *Myocarditis (Coxsackie Virus Carditis) atau pericarditis*

– *Acute Flaccid Paralysis

* / Lumpuh Layuh Akut (“*Polio-like illness*” )

Satu kelompok dengan penyakit ini adalah :

1. *Vesicular stomatitis dengan exanthem (PTKM) – Cox A 16, EV

71*(Penyakit ini)

2. *Vesicular Pharyngitis (Herpangina) – EV 70*

3. *Acute Lymphonodular Pharyngitis – Cox A 10*


*DIAGNOSA LABORATORIUM :*

Sampel ( Spesimen ) dapat diambil dari tinja, usap rektal, cairan

serebrospinal dan usap/swab ulcus di mulut/tenggorokan, vesikel di kulit

spesimen atau biopsi otak.

Spesimen dibawa dengan “*Hank’s Virus Transport*”. Isolasi virus dengan cara

biakan sel dengan *suckling mouse inoculation*. Setelah dilakukan “*Tissue

Culture*”, kemudian dapat diidentifikasi strainnya dengan antisera tertentu

/ IPA, CT, PCR dll. Dapat dilakukan pemeriksaan antibodi untuk melihat

peningkatan titer.

Diagnosa Laboratorium adalah sebagai berikut :

1. Deteksi Virus :

– *Immuno histochemistry (in situ)*

– *Imunofluoresensi antibodi* (indirek)

– Isolasi dan identifikasi virus.

Pada sel Vero ; RD ; L20B

Uji netralisasi terhadap intersekting pools

Antisera (*SCHMIDT pools*) atau *EV-71 (Nagoya)* antiserum.

2. Deteksi RNA :

RT-PCR

Primer : 5′ CTACTTTGGGTGTCCGTGTT 3″

5′ GGGAACTTCGATTACCATCC 3″

Partial DNA sekuensing (*PCR Product*)

3. Serodiagnosis :

*Serokonversi paired sera* dengan uji serum netralisasi terhadap virus

*EV-71 (BrCr, Nagoya)* pada sel Vero.

Uji ELISA sedang dikembangkan.

Sebenarnya secara klinis sudah cukup untuk mendiagnosis PTKM, hanya

kita dapat mengatahui apakah penyebabnya *Coxsackie A-16* atau *Enterovirus

71*.


*PENGOBATAN*


1. Istirahat yang cukup

2. Pengobatan spesifik tidak ada, jadi hanya diberikan secara

simptomatik saja berdasarkan keadaan klinis yang ada.

3. Dapat diberikan :

– *Immunoglobulin IV (IGIV)*, pada pasien imunokompromis atau neonatus

– *Extracorporeal membrane oxygenation*.

4. Pengobatan simptomatik :

– Antiseptik di daerah mulut

– Analgesik misal parasetamol

– Cairan cukup untuk dehidrasi yang disebabkan sulit minum dan karena

demam

– Pengobatan suportif lainnya ( gizi dll )

Penyakit ini adalah “*self limiting diseases*”, yaitu dapat sembuh

dengan sendirinya, dalam 7-10 hari, pasien perlu istirahat karena daya tahan

tubuh menurun. Pasien yang dirawat adalah yang dengan gejala berat dan

komplikasi tersebut diatas.


*PENCEGAHAN*


*PENCEGAHAN DAN PENGENDALIAN PENYAKIT:*

Penyakit ini sering terjadi pada masyarakat dengan sanitasi yang kurang baik. Pencegahan penyakit adalah dengan menghilangkan kekumuhan dan kepadatan lingkungan; kebersihan (Higiene dan Sanitasi) lingkungan maupun perorangan. Cara yang paling gampang dilakukan adalah misalnya membiasakan selalu cuci tangan, khususnya sehabis berdekatan dengan penderita, desinfeksi peralatan makanan, mainan, handuk yang memungkinkan terkontaminasi.

Bila perlu anak tidak bersekolah selama satu minggu setelah timbul rash sampai panas hilang. Pasien sebenarnya tak perlu diasingkan karena ekskresi virus tetap berlangsung beberapa minggu setelah gejala hilang, yang penting menjaga kebersihan perorangan.

Di Rumah sakit “*Universal Precaution*” harus dilaksanakan.

Penyakit ini belum dapat dicegah dengan vaksin (Imunisasi)

*UPAYA PEMERINTAH DALAM HAL INI :*

Meningkatkan survailans epidemiologi (perlu definisi klinik)

Memberikan penyuluhan tentang cara-cara penularan dan pencegahan PTKM untuk

memotong rantai penularan.

Memberikan penyuluhan tentang tanda-tanda dan gejala PTKM

Menjaga kebersihan perorangan.

Bila anak tidak dirawat, harus istirahat di rumah karena :

- Daya tahan tubuh menurun.

- Tidak menularkan kebalita lainnya.

Menyiapkan sarana kesehatan tentang tatalaksana PTKM termasuk

pelaksanaan “*Universal

Namun ini pun tak mudah. Seorang penderita dengan gejala flu, contohnya, akan

diduga menderita influenza. Padahal belum tentu penyebabnya virus influenza

karena untuk memastikan virus tertentu butuh pemeriksaan lama. Akhirnya, dokter

hanya mengobati gejalanya saja. Kalau demam diberi obat antidemam, sedangkan

jika disertai batuk akan ditangkal dengan obat batuk.

Namun karena jenis virus yang menyerang tidak diketahui secara pasti, maka

biasanya penderita tidak diberi obat antivirus. Apalagi sifat virus umumnya

susah dimatikan, sehingga si penderita susah diobati. Makanya, ujar Alan,

dokter kerap tak mau ambil risiko memperparah penyakit yang diderita pasien.

Akibatnya, tak sedikit dokter yang lantas menembaknya dengan antibiotik. Dengan

asumsi mungkin penyebabnya bukan virus, melainkan bakteri. Bukankah bakteri

akan mati jika dihantam dengan antibiotik?

YANG PENTING STAMINA

Lalu apa yang bisa dilakukan untuk menghadapi berbagai kemungkinan penyakit

tadi? Saran Alan, ketimbang kelewat mengkhawatirkan sekian banyak macam

penyakit maupun pengobatannya, lebih baik jaga stamina alias daya tahan tubuh

agar tetap prima. Soalnya, seseorang hanya mungkin terjangkit penyakit bila

daya tahan tubuhnya melemah. Minum vitamin C yang banyak didengungkan memang

merupakan salah satu cara membantu meningkatkan daya tahan tubuh.

Yang tak kalah penting, lantaran penyakit yang disebabkan virus cepat menular,

maka penderita yang sudah telanjur terkena harus sadar diri untuk segera

memutus rantai penularan. Solusinya dengan beristirahat di rumah. Ini penting

bagi penderita sekaligus bagi orang lain di lingkungannya agar tidak tertular.

Jangan lupa gunakan masker sehingga virus yang bisa disebarkan melalui udara

maupun percikan air liur tidak “lari” ke mana-mana.

Vaksin Influenza

Khusus influenza yang disebabkan virus influenza, menurut Alan, memang ada

tindak pencegahan berupa vaksinasi. Hanya saja vaksin tersebut akan berubah

setiap tahun tergantung hasil penelitian yang dilakukan para ahli. Contohnya,

sewaktu virus Hong Kong mewabah, maka di tahun itu pula dibuat vaksin untuk

melawan virus tersebut. Namun karena tahun berikutnya jenis virus berubah,

vaksin yang diproduksi pun berubah. Mau tidak mau yang bersangkutan perlu

divaksin kembali di tahun-tahun berikut. Soalnya, penyebab virus influenza akan

berbeda-beda setiap tahunnya. Mungkin saja virusnya masih sama, namun bermutasi

lalu membentuk suatu jenis virus baru.

Tentu saja tidak semua orang wajib mendapatkan vaksinasi influenza. Yang

dianjurkan adalah mereka yang memiliki penyakit tertentu yang bakal lebih parah

bila ia terserang influenza. Penderita asma, contohnya, akan mengalami keluhan

sesak napas yang parah bila terkena flu. “Sayangnya, orang masih sering salah

kaprah. Mereka beranggapan kalau sudah disuntik vaksin influenza pasti tak

bakalan terkena batuk pilek. Padahal kalau ia diserang batuk pilek yang

disebabkan bakteri tentu tidak bisa dicegah oleh vaksinasi influenza ini.”

Meler Karena Alergi

Mengingat gejala flu yang akrab ditemui adalah batuk pilek, Alan mengingatkan

jangan gara-gara batuk pilek sedikit saja lantas cepat-cepat minum obat flu.

Boleh jadi penyebabnya bukan virus influenza, melainkan alergi terhadap

sesuatu, semisal dingin atau debu. Sering dengar, kan, keluhan para orang tua,

“Anakku enggak demam, tapi, kok, hidungnya meler terus, sih.”


Sekadar Nama

Berikut beberapa penyakit yang menggunakan kata flu, namun sebetulnya bukan

influenza.

"MACAM FLU"

FLU SINGAPURA

“Flu” jenis ini sempat menggemparkan dunia beberapa tahun lalu. Padahal

penyakit yang sering disebut dengan HFMD (Hand-Foot and Mouth Disease) atau

Penyakit Mulut, Kaki dan Tangan (MKT) ini sebenarnya merupakan penyakit kulit.

Kalaupun orang menyebutnya sebagai penyakit flu, tak lain karena gejala

penyakitnya hampir sama dengan influenza. Penyakit yang disebabkan virus

Coxsackie 16 ini sebenarnya merupakan penyakit yang umum terjadi pada anak dan

bayi. Terlebih karena virus ini bisa menyerang sepanjang tahun.

Selama 1-2 hari pertama ditandai dengan suhu badan meninggi, batuk pilek,

mual-mual, dan tak nafsu makan. Kemudian muncul gejala bintil-bintil atau

visikel seperti cacar air di daerah tangan, kaki, dan selaput mukosa mulut

serupa sariawan. Bintil dan lepuhan berisi cairan bening yang mengandung virus

ini sangat mudah menular, baik lewat percikan ludah saat bersin, sentuhan

dengan bagian tubuh yang berbintil tadi ataupun penggunaan kebutuhan rumah

tangga secara bersama seperti handuk.

FLU HONG KONG

Disebut juga dengan flu burung (avian flu) yang muncul sekitar Maret 1997.

Jenis flu ini awalnya menyerang unggas di Hong Kong. Namun 2 bulan kemudian

juga menyerang seorang bocah laki-laki berusia 3 tahun di Kowloon yang akhirnya

meninggal. Setelah diteliti, ternyata penyebabnya tak lain adalah virus flu

burung tersebut. Di akhir tahun 1997 muncul pula infeksi dengan komplikasi

berat seperti pneumonia dan ensefalitis (radang selaput otak). Kalau tidak

segera ditangani, infeksi ini bisa berakibat fatal. Pemerintah Hong Kong

akhirnya memutuskan untuk melakukan pemberantasan besar-besaran dengan

memusnahkan semua unggas yang dijualbelikan di pasaran.

FLU BABI

Ditilik dari namanya, virus penyebab flu yang juga disebut sebagai swine flu

ini berasal dari babi. Sumber penyebarannya diperkirakan berasal dari sebuah

tanah pertanian di daerah Midwest, AS, tanah peternakan babi. Banyak ahli

memang percaya bahwa sebelum sampai di tubuh manusia, semua gen virus flu

memiliki tempat-tempat persinggahan sebagai vektor penyebarannya. Salah satunya

yakni melalui hewan.

FLU TULANG

Umumnya semua gejala flu/selesma atau common cold muncul karena infeksi

berbagai jenis virus. Dari sekian banyak virus penyebab flu, ada yang

menghasilkan toksin/zat racun bagi tubuh. Zat racun ini kemudian menyebabkan

berbagai gangguan fungsi pada sistem tubuh individu yang terkena. Di antaranya

pada sistem otot rangka. Selain membuat tubuh yang bersangkutan memberikan

reaksi radang, di antaranya berupa demam dan nyeri otot dan tulang serta

memunculkan warna kemerahan pada mukosa yang mengindikasikan melebarnya

pembuluh kapiler di bawahnya. Berdasarkan gejala itulah, beredar istilah flu

tulang.

FLU PERUT

Seperti telah dikatakan, toksin yang dihasilkan oleh virus penyebab flu tadi

akan menyebabkan berbagai gangguan. Termasuk gangguan terhadap fungsi sistem

pencernaan yang antara lain ditunjukkan melalui gejala mual, muntah, diare dan

mulas. Atau bisa pula mengganggu fungsi usus, hingga pencernaan jadi tidak

sempurna dan menghasilkan banyak gas. Gejala-gejala tersebut belakangan sering

disebut sebagai flu perut.

Rizanet

Pendahuluan:

Seorang anak yang menderita kehilangan minat di makan makanan padat? Mungkin anak

menderita penyakit tangan-kaki-mulut.

Apa itu?

Tangan-kaki-mulut penyakit adalah balita sakit umum yang menampilkan luka mulut,

demam, dan ruam. Mirip-terdengar "kaki-dan-mulut penyakit" adalah penyakit

ternak dan tidak berhubungan dengan kondisi ini.

Tangan-kaki-mulut penyakit biasanya disebabkan oleh virus yang disebut coxsackievirus

A16. Namun, banyak anak dengan infeksi A16 coxsackievirus tidak memiliki

semua fitur penyakit tangan-kaki-mulut. Beberapa memiliki ruam tidak, beberapa memiliki

tidak luka mulut, dan beberapa bahkan telah demam. Berbagai virus lainnya di

Enterovirus keluarga juga dapat menyebabkan penyakit tangan-kaki-mulut (yang

coxsackieviruses adalah enterovirus).

Siapa yang bisa mendapatkan itu?

Penyakit ini paling umum di antara anak-anak muda, namun terlihat dengan beberapa

frekuensi sampai pubertas. Dewasa bisa mendapatkannya, tetapi ini jauh kurang umum.

Begitu orang telah A16 coxsackievirus mereka umumnya kekebalan tubuh, tetapi mereka

bisa kasus lain penyakit kaki tangan mulut dari satu sama lain,

kurang umum virus. Sebagian besar infeksi terjadi pada musim panas atau awal musim gugur, dengan

puncak antara Agustus dan Oktober di belahan bumi utara.

Apa saja gejalanya?

Anak-anak dengan penyakit tangan-kaki-mulut biasanya mulai merasa tdk bagus 3-7

hari setelah mereka terkena. Sering kali, orang tua hal pertama yang mereka perhatikan adalah

anak-anak kurang nafsu makan untuk makanan padat. Anak-anak juga mungkin mengalami demam dan

sakit tenggorokan. Satu atau dua hari kemudian, banyak anak-anak mengembangkan luka di dalam mulut.

Mereka mulai sebagai bintik-bintik merah kecil di lidah, gusi, atau selaput lendir. Mereka

mungkin melepuh atau bentuk ulkus.

Sebuah ruam kulit juga dapat mengembangkan lebih dari satu atau dua hari, dengan datar atau mengangkat merah

spot. Berbeda dengan banyak ruam, bintik-bintik sering ditemukan di telapak tangan dan

sol. Juga, adalah umum untuk memiliki ruam di pantat. Seringkali, merah

bintik-bintik akan membentuk lepuh tender (walaupun bukan pada pantat). Berbeda dengan

cacar air, ruam tidak gatal.

Biasanya ruam menghilang dan anak itu merasa lebih baik dalam waktu sekitar 1 minggu.

Bagaimana penyakit ini didiagnosis?

Biasanya diagnosis dibuat berdasarkan sejarah dan pemeriksaan fisik. Laboratorium

tes yang tersedia untuk coxsackieviruses dan enterovirus lainnya, tapi

mereka biasanya tidak diperlukan. Tangan-kaki-mulut kadang-kadang penyakit

membingungkan dengan strep throat, yang juga dapat dimulai dengan demam dan sakit

tenggorokan. Kadang-kadang keliru untuk cacar air karena mereka berdua telah

lepuh. Juga banyak anak dengan penyakit tangan-kaki-mulut yang didiagnosis dengan infeksi telinga

karena gendang mungkin tampak merah.

Bagaimana disembuhkan?

Antibiotik tidak membantu dengan penyakit tangan-kaki-mulut. Yang penting masalah

adalah nyeri bantuan dan banyak cairan.

Bagaimana bisa dicegah?

Virus yang menyebabkan penyakit tangan-kaki-mulut yang hadir baik dalam tinja

dan di sekresi pernafasan. Ini bisa menyebar dengan transmisi fecal-oral,

tetesan transmisi, transmisi kontak, dan dengan cara fomites.

Cuc tangan terutama setelah mengganti popok / toilet dan sebelum makan-dapat membantu

mengurangi penyebarannya. Anak-anak seringkali dijauhkan dari sekolah atau tempat penitipan anak untuk

pertama beberapa hari sakit, tetapi tidak jelas ini mencegah orang lain

dari terinfeksi. Anak-anak lain di kelas mungkin menular

meskipun mereka tidak pernah akan mengembangkan gejala.

Tujuan dari brosur ini adalah untuk memberikan tips bermanfaat tentang cara merawat

anak Anda atau anak-anak dengan tangan Penyakit Mulut dan Kuku (HFM). Kita

mengerti bahwa Anda sangat khawatir dan prihatin, dan kami ingin

berbagi beberapa tips bermanfaat tentang cara mengasuh anak Anda di rumah.

Dengan cara ini, kita dapat mencegah komplikasi seperti dehidrasi akibat menolak untuk minum cairan.

1. Masa inkubasi

Masa inkubasi setelah kontak bervariasi dari 2 sampai 6 hari, dan Anda

demam anak dan ketidaknyamanan mulut biasanya berlalu Hari 3 atau 4. Itu

borok mulut menyelesaikan by Day 5 sampai Hari 7 penyakit, tetapi air kecil

lepuh atau bintik-bintik merah di tangan, kaki (dan kadang-kadang pantat dan

anggota badan) dapat berlangsung hingga 10 hari. Kadang-kadang, anak Anda mungkin mengadu rasa sakit

selama lepuh atau bintik terletak di telapak tangan dan telapak kaki. Anda anak

demam setinggi 39oC.

2. Bagaimana mengasuh anak Anda di rumah:

a) Jika bisul mulut anak Anda yang menyakitkan, Anda akan melihat drooling

dan kesulitan makan. Anda dapat memberi anak Anda Panadol sirup (yang sebenarnya

nama obat adalah "acetaminophen") untuk meringankan rasa sakit mulut yang parah serta

demam. Kami sarankan Anda berbentuk sirup Panadol 30 menit sebelum setiap makan (sarapan, makan siang, dan makan malam). Aman untuk minum Panadol meskipun perut kosong.

Ingatlah untuk minum Panadol hanya pada interval 4 atau 6 atau 8 jam. Jika anak Anda alergi terhadap Panadol, harap informasikan dokter anak segera.

Silahkan mencari nasihat dokter anak Anda jika Anda berniat untuk melayani obat lain

seperti tablet Voltaren retard atau Voren (diklofenak) supositoria atau sirup ibuprofen oral.

Resep obat ini lebih kuat dari Panadol dan mungkin tidak cocok untuk beberapa anak.

b) Jika Anda sendiri atau memberikan campuran mengobati anak Anda atau batuk

antihistamin oral, mohon informasikan dokter anak Anda. Beberapa anak

mengantuk setelah campuran obat batuk dan antihistamin, dan ini dapat menyebabkan

kantuk. Kami menyarankan agar Anda mengobati batuk dan sebanyak mungkin minum cairan dan ini dapat menghindari dehidrasi. Mengantuk dianak Anda mungkin merupakan tanda awal infeksi otak juga.

c) Usahakan banyak masukan cairan yang sehat dan pengaturan asupan diet.

Anak-anak dengan borok mulut menyakitkan sulit mengisap dot botol

- Kami menyarankan Anda memanjakan anak Anda lebih sabar lagi. Beberapa anak-anak suka

minum dari sedotan atau gelas. Anda dapat melayani bayi dan anak-anak muda

buatan bubur air, air barley atau teh chrysanthenum alternatif lain adalah minum setengah-lemon-lime soda seperti 'Sprite' atau '7 up ',

disajikan pada suhu ruang untuk anak-anak di atas usia satu tahun. Tidak disarankan

'Sprite' atau '7 up 'untuk bayi di bawah usia satu tahun! Ingatlah untuk mengocok

soda sampai mendesis itu akan menghilangkan gelembung yang dapat mengggembungkan sakit perut anak

, dan kemudian menambahkan air untuk mencairkan Sprite . Menghindari

memberikan anak Anda asam, asin atau pedas makanan dan menghindari makanan yang membutuhkan banyak

mengunyah. Soft jeli, es krim mencair dan kentang tumbuk dapat ditawarkan

untuk camilan di samping diet biasa dari bubur atau roti.

d) Mendorong anak Anda untuk minum lebih banyak cairan sehingga mereka akan "pipis"

setidaknya setiap 3-5 jam. Kami sarankan Anda bangun anak sakit Anda di 2

atau 3 pagi di pagi hari untuk mengukur suhu-nya, jika perlu Panadol dan mendorong anak Anda untuk minum

sebelum dia kembali tidur. Hal ini penting untuk mencegah dehidrasi pada anak Anda.

e) Bagaimana mengobati gel mulut: Gunakan sepotong kain kasa bersih atau kapas bersih

handuk untuk menyeka itu luka mulut, sebelum mengobati gel mulut. Jika Anda tidak

mengusap air liur, gel tidak akan menimbulkan sakit maag! Yang terbaik

waktu adalah untuk menerapkan gel mulut sebelum makan dan sebelum tidur. Anda dapat membeli

Medigel atau Bonjela dari apotek yang tanpa resep. Jangan berbagi gel mulut dengan anak lain.

f) Cuci tangan dengan sabun atau desinfektan setelah Anda

memegang anak Anda. Virus ini hadir dalam tinja dan tubuh semua cairan. Jangan biarkan anak Anda untuk berbagi handuk, sikat gigi, gelas atau botol dengan anggota keluarga, dan mengingatkan anak untuk mencuci tangan nya. Setelah lepuh dan bisul hilang, jangan biarkan anak Anda berpartisipasi olahraga aktif selama dua hingga tiga minggu setelah penyakit HFM.

Silakan hubungi dokter Anda atau kembali ke rumah sakit jika:

1. Jika anak Anda tidak buang air kecil atau 'kencing' selama lebih dari 6 jam. Harap dicatat jam kencingnya

2. Anak Anda mulai bertindak "sangat sakit" (terlihat membosankan, mengantuk, pucat atau

burik, gelisah atau mudah tersinggung dan tidak bisa tidur, atau berkeringat dingin).

3. Demam berlangsung lebih dari 3 hari.

4. Rasa sakit mulut menjadi parah.

5. Anak Anda menderita kelemahan di tungkai atau kejang

6. Sama sekali tidak mau makan dan minum setidaknya kehilangan dehidrasi.

Sekian.

"TIP MUDAH OBATNYA"

Untuk Anakku Ratu Erlina (18 bulan) yang lagi kena Flu Singapore semoga lekas sembuh ya.
Tip mengobatinya :
Obat penurun panas/Proris/Paracetamol dan Vitamin serta ACYCLOVIR tablet dan amoxilin (untuk mengobati luka cepat sembuh) interval 4 or 6 jam, Minum yang banyak tiap 30 menit, Istirahat yang banyak kalau perlu libur 2 hari soalnya Virus juga dapat menular keorang disekeliling.


Salepi Bintik merah/Luka dengan ACYCLOVIR yang salep agar cepat mengering.


Umumnya Flu Singapore ini dapat sembuh dengan sendirinya setelah 5 s/d 10 hari.

by Rizanet
Kembali keatas -!-

Comments :

0 comments to “FLU SINGAPORE FLU BURUNG FLU TULANG FLU PERUT DAN CARA MENGOBATINYA BY RIZANET”

Posting Komentar

Sarankan dengan bijak dan sopan maka kami akan menghargai anda.

-^- Kembali keatas -^-

 

KOMPAS.com

Foto Saya
RIZANET
Indonesia
Untuk Koleksi Pribadi agar mudah mencari artikel saya
Lihat profil lengkapku

ANTARA - Berita Terkini

PAPA...PERSIAPKANLAH MASA DEPAN ANAK KITA KARENA DIA AKAN HIDUP DIMASANYA BUKAN LAGI DIWAKTU KITA... ANAK ADALAH TITIPAN TUHAN JADI BUKAN KOMODITI DIHARI TUA KITA... BERILAH SELALU KASIH SAYANG KEPADA ANAK KITA KARENA ESOK DIA AKAN PENUH CINTA KEPADA SESAMANYA...MAMA RATU ERLINA DAN ELVIRA